Mycologia Iranica
Volume:8 Issue: 1, Winter and Spring 2021

In March 2019, a number of synnematous fungal specimens were isolated from the dead tissues of Pistachio vera (pistachio) seedlings in a greenhouse at the Azarbaijan Shahid Madani University of Tabriz, Iran. Preliminary identification based on morphological characteristics showed that the fungal isolates belong to the genus Cephalotrichum. Two species namely C. asperulum and C. gorgonifer were identified by combining morphology and phylogeny inferred from ITS-rDNA sequence. To our knowledge, C. gorgonifer is a new record for the Iranian Funga. Moreoverpistachio is matrix nova for C. aspeerulum and C. gorgonifer.

During surveys from walnut orchards of Hamedan and Kermanshah provinces, black spots on twigs of walnut trees were observed between 2018 and 2019. Due to the prevalence of these symptoms on the twigs of walnut trees, the samples were transported to the mycology laboratory for further investigations. After isolation and purification on PDA medium, 19 isolates were obtained from symptomatic twigs. Microscopic observations were conducted for grouping and morphological identifications. Based on morphological traits, two representative isolates were selected for molecular identifications. Molecular identification based on Internal Transcribed Spacer (ITS) region, indicated that these isolates were Uzbekistanica vitis-viniferae and U. yakutkhanika. Pathogenicity examinations were showed these isolates were pathogenic on walnut shoots in the laboratory conditions. To the best of our knowledge, this is the first report of Uzbekistanica as a new genus for Funga of Iran. Moreover, walnut tree is new host for U. vitis-viniferae and U. yakutkhanika.

White blister rust causal agents, previously assigned to the genus Albugo, are obligate plant pathogens affecting numerous plant families. The genus Wilsoniana has been erected from the genus Albugo to accommodate species infecting hosts in the Caryophyllales. Starting from spring 2018, we observed symptoms resembling white blister rust disease on leaves of Amaranthus retroflexus L. in the northern Iran. The specimens were subjected to molecular study by analyzing cox2, LSU and ITS rDNA sequences and morphological data sets. The results confirmed that the specimens belong to Wilsoniana amaranthi (Schwein.) Y.J. Choi, Thines & H.D. Shin (Albuginales, Oomycota). To our knowledge, this is the first confirmed and documented record of W. amaranthi (ex Amaranthus retroflexus) from both Iran and West Asia. The results of this study will provide a reference for further resolution of W. amaranthi species concept.

Lemons are susceptible to the post-harvest decay caused by Penicillium digitatum and Alternaria alternata, causing the green mold and black rot disease, respectively. The current study aimed to investigate the potential impact of salicylic acid (SA) as a natural defense inducer on radical growth, spore germination, and disease development afflicted by P. digitatum and A. alternata. Antifungal activities of SA were determined in vitro by plating fungal cultures on medium supplemented to various SA concentrations (0, 1, 2, 4, 6, 8, and 16 mM). Our in vitro experiments demonstrated that SA significantly reduced conidial germination and the radial growth of both pathogens in a dose-dependent manner. Moreover, in vivo assays confirmed that SA remarkably reduced lesion diameter on the lemon fruits treated by 8- and 16-mM SA before inoculation by both tested pathogens. To sum up, we suggested a potential implication of SA as a post-harvest treatment to control P. digitatum and A. alternata on a lemon at commercial scales.

Three specimens of Entoloma genus were collected from Kermanshah province, west of Iran. Macro and micro-morphological features of the fungal specimens were examined. The ITS1 and ITS4 Primer pair was used to amplify ITS-rDNA. Phylogenetic analyses of ITS-rDNA sequences were carried out using Maximum Likelihood method with 1000 bootstrap repetitions. Based on the results obtained from morphological examinations along with data obtained from ITS- rDNA sequences, three species including Entoloma phaeocyathum, E. sinuatum, E. undulatosporum were identified. E. sinuatum has previously been reported from Iran, therefore this study represents the first record of E. phaeocyathum and E. undulatosporum from Iran.

This study aimed to evaluate nutritional value and identify the mycochemical composition of winter truffles (Tuber brumale) with two different flesh colors (dark and bright) that were found in the Hyrcanian forests (Iran). The; carbohydrates, protein, and fat content were 11.3 mg. g-1 dry weight, 12.53%, and 2.41% in dark winter truffle and 12.64 mg. g-1 DW, 11.06%, and 2.4% in bright type, respectively. Although the results of GC-MS analysis showed that fatty acids and esterified fatty acids are the most abundant in methanolic extracts, ergosterol was the dominant compound in methanolic extracts, which was quantified 15.88 and 12.89% in dark and bright types, respectively. The most identified compounds in n-hexane extracts were alkanes. Also, the amount of ergosterol, as the dominant compound in n-hexane extracts, was quantified 32.41 and 24.3% in dark and bright winter truffles, respectively. In the methanolic extract of dark T. brumale, the Phenol, 2-methyl-5-(1- methyl ethyl) or carvacrol were measured 0.25%. The 2,4-Di-tert-butylphenol was one of the phenolic compounds which were discovered at 0.54% in n-hexane extract of bright winter truffle. Also, squalene as a natural triterpene was identified in methanolic and n-hexane extracts of both types of T. brumale. The most concentration of squalene (1.91%) was recorded in n-hexane extract of dark T. brumale.

Botrytis cinerea has a wide host range, the possibility of hiding plant infection from the initial stages, and causing severe damage (even up to 100%) to the host.  Due to the chance of growth and activity of the pathogen in field, greenhouse, in laboratory, and even in cold storage conditions, its importance is increasing. The presence of pathogen in seedlings, mature plants, ripe fruits, and even storage conditions in different parts of Iran and its importance, we decided to investigate the genetic diversity of the isolates using the ISSR marker. For this purpose, 21 isolates including 16 isolates from the collection of the University of Tehran (isolated from seedling and leaf of cauliflower, grizzly lettuce, needled lettuce, purple basil, onion, tomato, strawberry and pomegranate) and five isolates collected from two strawberry greenhouses in Alborz province, were used. Ten ISSR primers were used to determine the genetic diversity. Analyzing the results by NTSYS software version 2.02e (based on SM and UPGMA clustering method) showed that the isolates fall into four fingerprinting groups. It was also observed that the resulting bands have 100% polymorphism (93.33% in one case). The calculated cophenetic coefficient for the data (0.89) confirmed the accuracy of the obtained dendrogram. Evidence suggests that there is high genetic diversity in B. cinerea isolates and also there is no relationship between host and geographical region.

A new species of Acaulospora was found in the mountainous region of Iran (Kerman province, Raviz), at 2118 m asl around the roots of Prunus cerasus. The new species was named A. punctata by Ohel, 2013, because of its ornamentation on the outer spore wall with point-like. The spores are yellow-white, globose to subglobose, 105–139 µm in diameter, and have three walls that each of which consists of some layers. Phylogenetic analyses of sequences obtained from the ITS and partial LSU & SSU of the ribosomal genes confirm the new species in a separate clade within the Acaulosporaceae. According to the phylogenetic analysis, the fungus as named b-pooneh placed in a monophyletic group within the genus Acaulospora next to Acaulospora covernata, and A. ignota.

Gyromitra Fr. is a widespread genus of apothecial ascomycetous fungi with 18 species. The genus had previously been grouped in Rhiziniaceae and Helvellaceae families. Analysis of the rDNA showed Gyromitra is related to the genera Discina, Hydnotrya and Pseudorhizina and the genus was transferred to the Discinaceae (O'Donnell et al. 1997, Methven et al. 2013).In the framework of identifying of larger ascomycetous fungi of Iran, specimens of genus Gyromitra , collected from Mazandaran province, were identified as G. infula (Schaeff.) Quél. (van Nooren and Moreau 2009 a,b; Abbott and Currah, 1997), as a new report for genus Gyromitra in Iran.Morphological characteristics of specimens are as follows: Ascocarp is a stipitate apothecium with 3-8 cm high and 3-6 cm broad, cup-shaped when young, but soon becoming irregular, lobate (with two or occasionally three to four lobes) or saddle-shape. Upper surface more or less glabrous, wavy to irregularly bumpy, margin curved toward the stipe and eventually becomes fused to it. Cap yellowish-brown to orange brown, with black line or spots in curved margin; context, thin, brittle. Odor and taste not distinctiveStipe is 2-6 cm high, 1-2.5 cm thick, equal to enlarged at the base, with a longitudinal deep fold,and surface glabrous to pruinose. The base is often cover with whitish mycelium in dark background, pinkish to tinged lilac with darker zones in base(Fig 1).Asci are cylindrical, 8-spored, and 200-300 x 10-20 µm diameter. Ascospores are 17-20 x 7-9 µm, narrowly ellipsoid; with two large oil droplets, smooth, hyaline, thin-walled. Paraphyses are 6-10 µm wide, snd capitate with a swollen head (Fig 1).The saddle shaped ascocarp with two or more prominent lobes and color of ascocarp are specific characteristics for differentiation of G. infula from other Gyromitra species. Gyromitra infula is a poisonous fungus, due to its toxic constituent’s gyromitrin, that then turns into toxic compounds monomethylhydrazine.Specimens examined: Mazandaran: Noor, Chamestan, on wood, 100 m, 13.10.2010, Asef and Torabi (IRAN 15672 F), Mazandaran: Pool to Baladeh, on woody soil 10.09.2009, Asef and Torabi (IRAN 15673 F), Mazandaran: Noshahr, Kheiroudkenar, on wood, 05.10.2011, Jafarpur (IRAN 15674 F).

Travertine stone (Abbas Abad type) is one of the widely used stones in Iran. The mines of this stone, one of the most luxurious travertine stones in the world with a white-background color, are located in Mahalat, although its production is mainly carried out in Isfahan province. In our visits of various building stone sites in Hafiz town, Shiraz, Fars province in 2021, loose and rotten stones with black streaks were observed from which the rocks are cracked, causing a severe damage to stonework’s industry (Fig. 1a). To isolate fungi, small pieces (5 × 5 mm) of stone samples were surface disinfested with 0.5% sodium hypochlorite for 1 min, washed three times with sterilized distillate water and plated on potato dextrose agar (PDA; Merck, Darmstadt, Germany). Purification of isolates was done by hyphal tip technique. Among the isolated fungi, one isolate that was recovered from Imperator work stone in Hafiz town, Shiraz (Fars province) was identified as Ascotricha funiculosa (Guarro & Calvo) D.W. Li & G.H. Zhao, based on morphological features (Guarro and Calvo 1983) and sequences data. Macroscopic and microscopic features of the fungus are given here.Colonies were slow-growing, attaining a diameter of 17 mm in seven days on PDA (Merck, Darmstadt, Germany), first dull white, then becoming grayish with a white edge (Fig. 1b). The colony on the reverse side of the agar plate was blackish (Fig. 1c). Conidiophores were borne mostly as short vertical branches from individual hyphae, commonly 70-130 × 2.5–4.5 μm, composed of a differentiated supporting hyphae bearing sterile swollen cells hyaline and groups of conidiogenous cells. Stipe was smooth, simple or once branched, septate, hyaline when young, becoming olive-brown at maturity, swollen cells hyalin, sterile, thin-walled, 6-8 × 4-5 μm, rounded above (Fig. 1d-h). Conidiogenous cells were lateral and terminal, sympodial, developing conidia on denticles (Fig. 1g-h). Conidia were smooth, subglobose to ellipsoidal, unicellular, hyaline when young, becoming light brown at maturity, with a minute scar at the base, and 4–6 × 3.5–4.5 μm (x̄ = 5 × 3.5 μm, n = 100) (Fig. 1i).For confirmation of morphological identification, DNA of representative isolate was extracted using a commercial kit (Zagros Bioidea Co., Razi University Incubator, Kermanshah, Iran). PCR was performed using primers ITS1 (CCGTAGGTGAACCTGCGC) and ITS4 (TCCTCCGCTTATTGATATGC) for the internal transcribed spacer region (ITS1-5.8S-ITS2) of the nuclear ribosomal DNA (rDNA) (White et al. 1990), and Bt2a (GGTAACCAAATCGGTGCTGC TTTC) and Bt2b (ACCCTCAGTGTAGTGACCC TTGGC) for a part of the β-tubulin gene (Glass & Donaldson 1995). The PCR product was submitted for sequencing to a capillary sequencing machine (Pishgam Biotech Co., Tehran, Iran). The sequence generated in this study was deposited in GenBank under accession number OK324153 (ITS) and OK337389 (β-tubulin gene).BLAST analysis revealed a high nucleotide identity (99% for ITS and 98.7% for β-tubulin gene) with the ITS region and β-tubulin gene of Ascotricha funiculosa isolate CBS 323.86 (KU684134 and KU683762) that was recently reported from North American (Cheng et al. 2015). Two datasets, including individual aligned sequences of ITS, and the combined ITS and β-tubulin datasets (ITS- β-tubulin), were used to phylogenetic analysis of Ascotricha. Phylogenetic analyses were performed using maximum likelihood (ML) method in the MEGA Ver. X program (Kumar et al. 2018). Phylogenetic analyses based on ITS (Fig. 2), and combined ITS and β-tubulin gene sequences (Fig. 3) of our isolates and 22 selected isolates of Ascotricha (Table 1) showed that our isolates are closely related to A. funiculosa (Figs. 3, 4). The isolates formed a well-supported clade with the reliable reference strains of A. funiculosa (Figs. 2, 3), placed separately from the other species of Ascotricha. The result of the phylogenetic analysis was in accordance with the molecular identification based on DNA sequences in BLAST search, thus resolving the morphological identification.In Iran, Ascotricha chartarum has been reported from Abbas abad travertine stone (Jamali 2021). Information about of A. funiculosa is rare and this species previously has been reported from Spain. A. funiculosa differs from other species in the morphology of its conidiogenous cells (Guarro & Calvo 1983) and in lacking a sexual stage. In this study also, sexual stage was not seen in culture media. Ascotricha funiculosa is new to the Iranian funga, and is reported for the first time from building stone in the world. A subculture of this fungus is preserved at the Iranian Fungal Culture Collection of the Iranian Research Institute of Plant Protection (Tehran, Iran) under accession number IRAN 4558C. The genus Ascotricha (Ascomycetes, Xylariaceae) was erected by Berkeley in 1838 to accommodate the single species A. chartarum (Hawksworth 1971). So far, 29, and 30 Ascotricha species are recorded in the MycoBank and Index Fungorum, respectively.Many researchers have reported Ascotricha species in the China, Germany, India, Italy, New Zealand, North America, Portugal, and Spain, (Stchigel & Guarro 1998; Udagawa & Uchiyama 1999; Li & Yang 2004; U’Ren et al. 2016; Vu et al. 2019) but no such studies have been carried out in Iran.

The disease symptom was observed on the fruits of several Elaeagnus angustifolia trees in Nahavand Orchards, Iran, in September 2019. The symptom observed as dark, water-soaked lesions on the cortex of the fruits, eventually causing the entire fruit to rot (Fig 1-a). Diseased tissues were surface sterilized with ethanol 70% and aseptically transferred on to potato dextrose agar to identify the causal agent. After three days, dark olivaceous colonies appeared (Fig 1-b). The growing fungus was subcultured on SNA, and its colony was brownish green in color. Morphological observations were carried out after seven days of continuous exposure to near-ultraviolet light at 25°C (Bensch et al. 2012). Mycelium was unbranched or loosely branched, septate, sometimes slightly constricted at septa, hyaline to pale brown, smooth to minutely verruculose, and hyaline to pale brown. Conidiophores were solitary, micronematous and macronematous. Conidiogenous cells were terminal or intercalary, cylindrical, nodulose with lateral shoulders, or nodose with swellings around the stalk. Catenate conidia were found in branched chains, and small terminal conidia were subglobose, obovoid, oval, and limoniform, measuring 3–12 × 2–6 μm. Ramoconidia were broadly ellipsoid to subcylindrical, 13–23 × 6–9 μm long, verruculose to echinulate, with walls up to 1 μm thick. Conidia produced by micronematous conidiophores were typically smaller, narrower, and paler, catenate; in short unbranched or branched chains, subglobose, obovoid to limoniform, ellipsoid or fusiform, 3–16 × 2–5 μm, non-septate. The isolated fungus resembles C. macrocarpum in these characteristics, but differs from it in the absence of two cell conidia (Fig 1-c).Sequencing ITS-rDNA region and TEF1-α gene (Genebank accession numbers MZ021599, MZ234697) revealed 99.8% (MW842789) and 99.2% (DQ677891 (similarities to Cladosporium sp. Although the isolates in this study are morphologically similar to C. macrocarpum and are named as Cladosporium cf. macrocarpum, they could be a new Cladosporium species. As a result, additional molecular data is required for accurate identification. To test the pathogenicity of the fungus, detached fruits were inoculated with a conidial suspension of 105 spores ml-1. Healthy fruits were simultaneously sprayed with sterile distilled water as control. The inoculated fruits were kept in a plastic container containing sterile wet filter paper. The containers were kept at 25ºC for seven days. The experiments were performed three times. Sunken, brown lesions were observed after seven days in vitro (Brown & Britton. 1986), and the fungus was re-isolated (Fig 1-d). Pathogenicity was confirmed with Koch's postulates by comparing anamorph morphology. To our knowledge, this is the first report Cladosporium cf. macrocarpum has been identified as a causal agent of fruit rot on Elaeagnus angustifolia in the world.

Samples of a hair-like fungus were collected from Lahijan in Gilan province, nearby the excreta of Indian crested porcupine (Hystrix indica Kerr.). Microscopic observations showed long, erect, aerial sporangiophores of a mucor-like fungus with globular sporangia at the apex (Fig. 1 A, B, C, D). Sporangiophores were measured up to 15 cm in height, 100 to 400 µm diameter, and silvery to shiny black in color. Sporangia were yellow to brown or silvery to black, shiny, and 250 to 950 µm diameter. Specimens were transferred to PDA culture media and the colonies grew rapidly, covered culture media in about five days. Sporangiophores arose from basal mycelia and elongated to at least 4-5 cm in height and 50-75 µm in diameter, without septa, pale brown, brown to black, constricted below the sporangium, with positively intense phototropism. Sporangia were yellow, orange to black, globose, and 50-120 µm in diameter. Columella were pyriform, smooth, and light to dark brown, with clear collar (Fig. 1 E). Sporangiospores were smooth, hyaline, elliptical, and measured 12-30 × 6.5-15 µm (Fig.1 F). No zygospores found in the culture. Specimens were identified as Phycomyces nitens (C. Agardh) Kunze (Mucoromycota, Mucorales, Phycomyceteceae) based on Benjamin and Hesseltine (1959) and Camino et al. (2015). This is the first report of a species from genus Phycomyces in Iran. The absence of zygospore in the culture medium was due to that the P. nitens is a heterothallic species (Eslava & Alvarez 1996). Species of Phycomyces are saprobic filamentous fungi, historically belonged to Zygomycota and recently reclassified to a newly introduced phylum Mucoromycota (Spatafora et al. 2016).The genus Phycomyces was originally described as an algal species, Ulva nitens, by Agardh in 1817 (Benjamin and Hesseltine 1959) and hence the genus name was determined as Phycomyces. In 1823, Kunze recognized it as a fungus, and erected Phycomyces name for the genus and introduced P. nitens as type species of the genus (Kunze 1823). Three species have been recognized in Phycomyces, viz., P. blakesleeanus Burgeff, P. microspores Tiegh. and P. nitens throughout the world. They can be distinguished by the shape and size of the sporangiospores. In P. microspores sporangiospores are globose, whereas sporangiospores are elliptical in the other two species. Phycomyces blakesleeanus have sporangiospores with 6-12 µm length (Benjamin and Hesseltine 1959). ش Despite the widespread geographical distribution of P. nitens in Europe and the United States, this species has been reported only from Japan in the Asia (Camino et al. 2015).Species of Phycomyces are model organisms for studies of phototropism and geotropism, carotene biosynthesis and other aspects of metabolism, and also sexuality (Camino et al. 2015, Eslava and Alvarez 1996). Specimen examined: Iran, Gilan Province, Lahijan, Goharsara; nearby the excreta of Hystrix indica, 2021, Hatami, N and Varzkaari, F, IRAN 18094 F.